ID: 1076203276

View in Genome Browser
Species Human (GRCh38)
Location 10:128574808-128574830
Sequence CCGTCCCGCCTCCCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076203276_1076203285 30 Left 1076203276 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG No data
Right 1076203285 10:128574861-128574883 GGCAAAGCGTTTCAGTTCCTGGG No data
1076203276_1076203281 -4 Left 1076203276 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG No data
Right 1076203281 10:128574827-128574849 ACGGCACAGGCTCCGAACGCTGG No data
1076203276_1076203283 9 Left 1076203276 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG No data
Right 1076203283 10:128574840-128574862 CGAACGCTGGCACAGCAATTTGG No data
1076203276_1076203284 29 Left 1076203276 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG No data
Right 1076203284 10:128574860-128574882 TGGCAAAGCGTTTCAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076203276 Original CRISPR CCGTCCCGCCTCCCCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr