ID: 1076203281

View in Genome Browser
Species Human (GRCh38)
Location 10:128574827-128574849
Sequence ACGGCACAGGCTCCGAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076203278_1076203281 -5 Left 1076203278 10:128574809-128574831 CCACCTCGGGGAGGCGGGACGGC No data
Right 1076203281 10:128574827-128574849 ACGGCACAGGCTCCGAACGCTGG No data
1076203276_1076203281 -4 Left 1076203276 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG No data
Right 1076203281 10:128574827-128574849 ACGGCACAGGCTCCGAACGCTGG No data
1076203279_1076203281 -8 Left 1076203279 10:128574812-128574834 CCTCGGGGAGGCGGGACGGCACA No data
Right 1076203281 10:128574827-128574849 ACGGCACAGGCTCCGAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076203281 Original CRISPR ACGGCACAGGCTCCGAACGC TGG Intergenic
No off target data available for this crispr