ID: 1076206197

View in Genome Browser
Species Human (GRCh38)
Location 10:128605964-128605986
Sequence CTGTATACACACATGAAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076206197_1076206200 26 Left 1076206197 10:128605964-128605986 CCTCGCTTCATGTGTGTATACAG No data
Right 1076206200 10:128606013-128606035 GTCTGCTACCTATCAAAATCAGG No data
1076206197_1076206198 1 Left 1076206197 10:128605964-128605986 CCTCGCTTCATGTGTGTATACAG No data
Right 1076206198 10:128605988-128606010 CACACACACAAATCCTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076206197 Original CRISPR CTGTATACACACATGAAGCG AGG (reversed) Intergenic
No off target data available for this crispr