ID: 1076207225

View in Genome Browser
Species Human (GRCh38)
Location 10:128612897-128612919
Sequence GCGCCTGACCACTGGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076207225_1076207228 2 Left 1076207225 10:128612897-128612919 CCTGTGAGCCAGTGGTCAGGCGC No data
Right 1076207228 10:128612922-128612944 GATTTTGAAGAACAGAGCACAGG No data
1076207225_1076207230 4 Left 1076207225 10:128612897-128612919 CCTGTGAGCCAGTGGTCAGGCGC No data
Right 1076207230 10:128612924-128612946 TTTTGAAGAACAGAGCACAGGGG No data
1076207225_1076207231 25 Left 1076207225 10:128612897-128612919 CCTGTGAGCCAGTGGTCAGGCGC No data
Right 1076207231 10:128612945-128612967 GGAAATGTGTAAGTTTCCTGAGG No data
1076207225_1076207229 3 Left 1076207225 10:128612897-128612919 CCTGTGAGCCAGTGGTCAGGCGC No data
Right 1076207229 10:128612923-128612945 ATTTTGAAGAACAGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076207225 Original CRISPR GCGCCTGACCACTGGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr