ID: 1076211063

View in Genome Browser
Species Human (GRCh38)
Location 10:128645381-128645403
Sequence ACACAGTGAGAAGGGAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211063_1076211068 -6 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG No data
1076211063_1076211070 -4 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211070 10:128645400-128645422 GTGTCCACAAATGGTGGAAGGGG No data
1076211063_1076211069 -5 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211069 10:128645399-128645421 TGTGTCCACAAATGGTGGAAGGG No data
1076211063_1076211067 -10 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211067 10:128645394-128645416 CTCACTGTGTCCACAAATGGTGG No data
1076211063_1076211072 14 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211063 Original CRISPR ACACAGTGAGAAGGGAGTTT AGG (reversed) Intergenic
No off target data available for this crispr