ID: 1076211066

View in Genome Browser
Species Human (GRCh38)
Location 10:128645391-128645413
Sequence CTTCTCACTGTGTCCACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211062_1076211066 1 Left 1076211062 10:128645367-128645389 CCTGCTTTCTTGTTCCTAAACTC No data
Right 1076211066 10:128645391-128645413 CTTCTCACTGTGTCCACAAATGG No data
1076211061_1076211066 2 Left 1076211061 10:128645366-128645388 CCCTGCTTTCTTGTTCCTAAACT No data
Right 1076211066 10:128645391-128645413 CTTCTCACTGTGTCCACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211066 Original CRISPR CTTCTCACTGTGTCCACAAA TGG Intergenic
No off target data available for this crispr