ID: 1076211067

View in Genome Browser
Species Human (GRCh38)
Location 10:128645394-128645416
Sequence CTCACTGTGTCCACAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211063_1076211067 -10 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211067 10:128645394-128645416 CTCACTGTGTCCACAAATGGTGG No data
1076211062_1076211067 4 Left 1076211062 10:128645367-128645389 CCTGCTTTCTTGTTCCTAAACTC No data
Right 1076211067 10:128645394-128645416 CTCACTGTGTCCACAAATGGTGG No data
1076211061_1076211067 5 Left 1076211061 10:128645366-128645388 CCCTGCTTTCTTGTTCCTAAACT No data
Right 1076211067 10:128645394-128645416 CTCACTGTGTCCACAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211067 Original CRISPR CTCACTGTGTCCACAAATGG TGG Intergenic
No off target data available for this crispr