ID: 1076211068

View in Genome Browser
Species Human (GRCh38)
Location 10:128645398-128645420
Sequence CTGTGTCCACAAATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211061_1076211068 9 Left 1076211061 10:128645366-128645388 CCCTGCTTTCTTGTTCCTAAACT No data
Right 1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG No data
1076211062_1076211068 8 Left 1076211062 10:128645367-128645389 CCTGCTTTCTTGTTCCTAAACTC No data
Right 1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG No data
1076211063_1076211068 -6 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211068 Original CRISPR CTGTGTCCACAAATGGTGGA AGG Intergenic
No off target data available for this crispr