ID: 1076211070

View in Genome Browser
Species Human (GRCh38)
Location 10:128645400-128645422
Sequence GTGTCCACAAATGGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211063_1076211070 -4 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211070 10:128645400-128645422 GTGTCCACAAATGGTGGAAGGGG No data
1076211062_1076211070 10 Left 1076211062 10:128645367-128645389 CCTGCTTTCTTGTTCCTAAACTC No data
Right 1076211070 10:128645400-128645422 GTGTCCACAAATGGTGGAAGGGG No data
1076211061_1076211070 11 Left 1076211061 10:128645366-128645388 CCCTGCTTTCTTGTTCCTAAACT No data
Right 1076211070 10:128645400-128645422 GTGTCCACAAATGGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211070 Original CRISPR GTGTCCACAAATGGTGGAAG GGG Intergenic
No off target data available for this crispr