ID: 1076211072

View in Genome Browser
Species Human (GRCh38)
Location 10:128645418-128645440
Sequence AGGGGTGAAAGATCTCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211061_1076211072 29 Left 1076211061 10:128645366-128645388 CCCTGCTTTCTTGTTCCTAAACT No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data
1076211065_1076211072 5 Left 1076211065 10:128645390-128645412 CCTTCTCACTGTGTCCACAAATG No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data
1076211071_1076211072 -9 Left 1076211071 10:128645404-128645426 CCACAAATGGTGGAAGGGGTGAA No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data
1076211062_1076211072 28 Left 1076211062 10:128645367-128645389 CCTGCTTTCTTGTTCCTAAACTC No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data
1076211064_1076211072 6 Left 1076211064 10:128645389-128645411 CCCTTCTCACTGTGTCCACAAAT No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data
1076211063_1076211072 14 Left 1076211063 10:128645381-128645403 CCTAAACTCCCTTCTCACTGTGT No data
Right 1076211072 10:128645418-128645440 AGGGGTGAAAGATCTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211072 Original CRISPR AGGGGTGAAAGATCTCTCTT AGG Intergenic
No off target data available for this crispr