ID: 1076211215

View in Genome Browser
Species Human (GRCh38)
Location 10:128646502-128646524
Sequence GCTCCAATTGTCCCACTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076211215_1076211217 18 Left 1076211215 10:128646502-128646524 CCTGCTAGTGGGACAATTGGAGC No data
Right 1076211217 10:128646543-128646565 GCCTGGTCCTTAGTGTCATGTGG No data
1076211215_1076211221 28 Left 1076211215 10:128646502-128646524 CCTGCTAGTGGGACAATTGGAGC No data
Right 1076211221 10:128646553-128646575 TAGTGTCATGTGGTCCTTGGAGG No data
1076211215_1076211216 1 Left 1076211215 10:128646502-128646524 CCTGCTAGTGGGACAATTGGAGC No data
Right 1076211216 10:128646526-128646548 AGAGAATTCTAGAAAGAGCCTGG No data
1076211215_1076211220 25 Left 1076211215 10:128646502-128646524 CCTGCTAGTGGGACAATTGGAGC No data
Right 1076211220 10:128646550-128646572 CCTTAGTGTCATGTGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076211215 Original CRISPR GCTCCAATTGTCCCACTAGC AGG (reversed) Intergenic
No off target data available for this crispr