ID: 1076216153

View in Genome Browser
Species Human (GRCh38)
Location 10:128694921-128694943
Sequence GTTAATATGCATGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076216153_1076216160 22 Left 1076216153 10:128694921-128694943 CCTCCCTCCTCATGCATATTAAC No data
Right 1076216160 10:128694966-128694988 TAATTCACTGATTTTACATTCGG No data
1076216153_1076216158 -8 Left 1076216153 10:128694921-128694943 CCTCCCTCCTCATGCATATTAAC No data
Right 1076216158 10:128694936-128694958 ATATTAACAAATGGTATGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076216153 Original CRISPR GTTAATATGCATGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr