ID: 1076218673

View in Genome Browser
Species Human (GRCh38)
Location 10:128715956-128715978
Sequence CCCAGCACACAGGACCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076218673_1076218677 -10 Left 1076218673 10:128715956-128715978 CCATCCAGGTCCTGTGTGCTGGG No data
Right 1076218677 10:128715969-128715991 GTGTGCTGGGCCTCATCACCCGG No data
1076218673_1076218683 24 Left 1076218673 10:128715956-128715978 CCATCCAGGTCCTGTGTGCTGGG No data
Right 1076218683 10:128716003-128716025 GCGCCCGGCTTCCCAGTCCCTGG No data
1076218673_1076218682 9 Left 1076218673 10:128715956-128715978 CCATCCAGGTCCTGTGTGCTGGG No data
Right 1076218682 10:128715988-128716010 CCGGAGAGAGAGGCTGCGCCCGG No data
1076218673_1076218678 -1 Left 1076218673 10:128715956-128715978 CCATCCAGGTCCTGTGTGCTGGG No data
Right 1076218678 10:128715978-128716000 GCCTCATCACCCGGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076218673 Original CRISPR CCCAGCACACAGGACCTGGA TGG (reversed) Intergenic
No off target data available for this crispr