ID: 1076219610

View in Genome Browser
Species Human (GRCh38)
Location 10:128722677-128722699
Sequence GAGGGGAAACTGAGTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076219607_1076219610 -6 Left 1076219607 10:128722660-128722682 CCTTCGGATGGCTGCTCGAGGGG No data
Right 1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG No data
1076219600_1076219610 21 Left 1076219600 10:128722633-128722655 CCGCTGGCTGACATAAGGAAAGC No data
Right 1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG No data
1076219605_1076219610 -5 Left 1076219605 10:128722659-128722681 CCCTTCGGATGGCTGCTCGAGGG No data
Right 1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076219610 Original CRISPR GAGGGGAAACTGAGTCAGGC TGG Intergenic
No off target data available for this crispr