ID: 1076222204

View in Genome Browser
Species Human (GRCh38)
Location 10:128743281-128743303
Sequence AGACATATGCCACTGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076222204_1076222211 1 Left 1076222204 10:128743281-128743303 CCCCCCAGCAGTGGCATATGTCT No data
Right 1076222211 10:128743305-128743327 ACTTTGCACTTCCACATGGAGGG No data
1076222204_1076222210 0 Left 1076222204 10:128743281-128743303 CCCCCCAGCAGTGGCATATGTCT No data
Right 1076222210 10:128743304-128743326 GACTTTGCACTTCCACATGGAGG No data
1076222204_1076222214 30 Left 1076222204 10:128743281-128743303 CCCCCCAGCAGTGGCATATGTCT No data
Right 1076222214 10:128743334-128743356 ATAAACAGCAGTCATTAATCGGG No data
1076222204_1076222213 29 Left 1076222204 10:128743281-128743303 CCCCCCAGCAGTGGCATATGTCT No data
Right 1076222213 10:128743333-128743355 CATAAACAGCAGTCATTAATCGG No data
1076222204_1076222209 -3 Left 1076222204 10:128743281-128743303 CCCCCCAGCAGTGGCATATGTCT No data
Right 1076222209 10:128743301-128743323 TCTGACTTTGCACTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076222204 Original CRISPR AGACATATGCCACTGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr