ID: 1076224340

View in Genome Browser
Species Human (GRCh38)
Location 10:128762021-128762043
Sequence CTTCAGGGAAGCAGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076224340_1076224348 23 Left 1076224340 10:128762021-128762043 CCTGGGCTGCTGCTTCCCTGAAG No data
Right 1076224348 10:128762067-128762089 ATCGGAGTTTTCTGTGCTGCTGG No data
1076224340_1076224346 5 Left 1076224340 10:128762021-128762043 CCTGGGCTGCTGCTTCCCTGAAG No data
Right 1076224346 10:128762049-128762071 TGGTCTTCTTGCTCCAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076224340 Original CRISPR CTTCAGGGAAGCAGCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr