ID: 1076227421

View in Genome Browser
Species Human (GRCh38)
Location 10:128791230-128791252
Sequence ATCCATGAGCAATAGATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076227418_1076227421 24 Left 1076227418 10:128791183-128791205 CCTGAGACATGCAAAGCACTTAA No data
Right 1076227421 10:128791230-128791252 ATCCATGAGCAATAGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076227421 Original CRISPR ATCCATGAGCAATAGATAGG TGG Intergenic
No off target data available for this crispr