ID: 1076231960

View in Genome Browser
Species Human (GRCh38)
Location 10:128827563-128827585
Sequence GTGACCCCCATGTAATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076231960_1076231961 -2 Left 1076231960 10:128827563-128827585 CCTTGAGATTACATGGGGGTCAC No data
Right 1076231961 10:128827584-128827606 ACCCACAGCAAAATCCAGCTTGG No data
1076231960_1076231965 6 Left 1076231960 10:128827563-128827585 CCTTGAGATTACATGGGGGTCAC No data
Right 1076231965 10:128827592-128827614 CAAAATCCAGCTTGGTAGATGGG No data
1076231960_1076231964 5 Left 1076231960 10:128827563-128827585 CCTTGAGATTACATGGGGGTCAC No data
Right 1076231964 10:128827591-128827613 GCAAAATCCAGCTTGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076231960 Original CRISPR GTGACCCCCATGTAATCTCA AGG (reversed) Intergenic
No off target data available for this crispr