ID: 1076241342

View in Genome Browser
Species Human (GRCh38)
Location 10:128910404-128910426
Sequence CCTATGGGAGAAGTAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076241342_1076241352 20 Left 1076241342 10:128910404-128910426 CCCCTGTCTACTTCTCCCATAGG No data
Right 1076241352 10:128910447-128910469 AATTAACACTTCTTTACTTCTGG No data
1076241342_1076241348 -8 Left 1076241342 10:128910404-128910426 CCCCTGTCTACTTCTCCCATAGG No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241342_1076241353 21 Left 1076241342 10:128910404-128910426 CCCCTGTCTACTTCTCCCATAGG No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076241342 Original CRISPR CCTATGGGAGAAGTAGACAG GGG (reversed) Intergenic
No off target data available for this crispr