ID: 1076241347

View in Genome Browser
Species Human (GRCh38)
Location 10:128910419-128910441
Sequence CCGGGAGCCTTTTGACCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076241347_1076241352 5 Left 1076241347 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
Right 1076241352 10:128910447-128910469 AATTAACACTTCTTTACTTCTGG No data
1076241347_1076241354 21 Left 1076241347 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
Right 1076241354 10:128910463-128910485 CTTCTGGGTTTCATCACTTGAGG No data
1076241347_1076241353 6 Left 1076241347 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076241347 Original CRISPR CCGGGAGCCTTTTGACCTAT GGG (reversed) Intergenic
No off target data available for this crispr