ID: 1076241348

View in Genome Browser
Species Human (GRCh38)
Location 10:128910419-128910441
Sequence CCCATAGGTCAAAAGGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076241340_1076241348 -3 Left 1076241340 10:128910399-128910421 CCCATCCCCTGTCTACTTCTCCC No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241345_1076241348 -10 Left 1076241345 10:128910406-128910428 CCTGTCTACTTCTCCCATAGGTC No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241342_1076241348 -8 Left 1076241342 10:128910404-128910426 CCCCTGTCTACTTCTCCCATAGG No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241344_1076241348 -9 Left 1076241344 10:128910405-128910427 CCCTGTCTACTTCTCCCATAGGT No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241341_1076241348 -4 Left 1076241341 10:128910400-128910422 CCATCCCCTGTCTACTTCTCCCA No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
1076241339_1076241348 -2 Left 1076241339 10:128910398-128910420 CCCCATCCCCTGTCTACTTCTCC No data
Right 1076241348 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076241348 Original CRISPR CCCATAGGTCAAAAGGCTCC CGG Intergenic
No off target data available for this crispr