ID: 1076241353

View in Genome Browser
Species Human (GRCh38)
Location 10:128910448-128910470
Sequence ATTAACACTTCTTTACTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076241341_1076241353 25 Left 1076241341 10:128910400-128910422 CCATCCCCTGTCTACTTCTCCCA No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241345_1076241353 19 Left 1076241345 10:128910406-128910428 CCTGTCTACTTCTCCCATAGGTC No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241339_1076241353 27 Left 1076241339 10:128910398-128910420 CCCCATCCCCTGTCTACTTCTCC No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241347_1076241353 6 Left 1076241347 10:128910419-128910441 CCCATAGGTCAAAAGGCTCCCGG No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241342_1076241353 21 Left 1076241342 10:128910404-128910426 CCCCTGTCTACTTCTCCCATAGG No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241344_1076241353 20 Left 1076241344 10:128910405-128910427 CCCTGTCTACTTCTCCCATAGGT No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241340_1076241353 26 Left 1076241340 10:128910399-128910421 CCCATCCCCTGTCTACTTCTCCC No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data
1076241349_1076241353 5 Left 1076241349 10:128910420-128910442 CCATAGGTCAAAAGGCTCCCGGC No data
Right 1076241353 10:128910448-128910470 ATTAACACTTCTTTACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076241353 Original CRISPR ATTAACACTTCTTTACTTCT GGG Intergenic
No off target data available for this crispr