ID: 1076243774

View in Genome Browser
Species Human (GRCh38)
Location 10:128930375-128930397
Sequence AAAAATGCACAGTGGCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076243774_1076243778 -10 Left 1076243774 10:128930375-128930397 CCAATCTGCCACTGTGCATTTTT No data
Right 1076243778 10:128930388-128930410 GTGCATTTTTGACATAGTAGGGG No data
1076243774_1076243781 30 Left 1076243774 10:128930375-128930397 CCAATCTGCCACTGTGCATTTTT No data
Right 1076243781 10:128930428-128930450 TTGCAGCTCAGAAATGAAAATGG No data
1076243774_1076243779 2 Left 1076243774 10:128930375-128930397 CCAATCTGCCACTGTGCATTTTT No data
Right 1076243779 10:128930400-128930422 CATAGTAGGGGCCAGAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076243774 Original CRISPR AAAAATGCACAGTGGCAGAT TGG (reversed) Intergenic
No off target data available for this crispr