ID: 1076244510

View in Genome Browser
Species Human (GRCh38)
Location 10:128936023-128936045
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076244510_1076244517 3 Left 1076244510 10:128936023-128936045 CCCGACCCAGGCTGCCTTCAGTG No data
Right 1076244517 10:128936049-128936071 CACCATGGCAGCCACCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076244510 Original CRISPR CACTGAAGGCAGCCTGGGTC GGG (reversed) Intergenic
No off target data available for this crispr