ID: 1076250160

View in Genome Browser
Species Human (GRCh38)
Location 10:128978879-128978901
Sequence ATTGCTGCCCAGTGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076250160_1076250167 1 Left 1076250160 10:128978879-128978901 CCCTGTCCCCACTGGGCAGCAAT No data
Right 1076250167 10:128978903-128978925 GTTAGATTCGTTTGTCAAATGGG No data
1076250160_1076250166 0 Left 1076250160 10:128978879-128978901 CCCTGTCCCCACTGGGCAGCAAT No data
Right 1076250166 10:128978902-128978924 GGTTAGATTCGTTTGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076250160 Original CRISPR ATTGCTGCCCAGTGGGGACA GGG (reversed) Intergenic
No off target data available for this crispr