ID: 1076252447

View in Genome Browser
Species Human (GRCh38)
Location 10:128995177-128995199
Sequence TCACCCACTCCTGTCTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076252447_1076252452 -5 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252452 10:128995195-128995217 GGTGATCCAATGGGCCCAGAAGG No data
1076252447_1076252453 -1 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252453 10:128995199-128995221 ATCCAATGGGCCCAGAAGGCCGG No data
1076252447_1076252462 27 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252462 10:128995227-128995249 CAAAGTTGGATTTCAGGACCTGG No data
1076252447_1076252459 21 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252459 10:128995221-128995243 GCCCAACAAAGTTGGATTTCAGG No data
1076252447_1076252457 13 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252457 10:128995213-128995235 GAAGGCCGGCCCAACAAAGTTGG No data
1076252447_1076252463 28 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252463 10:128995228-128995250 AAAGTTGGATTTCAGGACCTGGG No data
1076252447_1076252464 29 Left 1076252447 10:128995177-128995199 CCCCAAGAGACAGGAGTGGGTGA No data
Right 1076252464 10:128995229-128995251 AAGTTGGATTTCAGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076252447 Original CRISPR TCACCCACTCCTGTCTCTTG GGG (reversed) Intergenic