ID: 1076252768

View in Genome Browser
Species Human (GRCh38)
Location 10:128996839-128996861
Sequence CAGGCTTATCCCCCCTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076252768_1076252773 11 Left 1076252768 10:128996839-128996861 CCAGCCTAGGGGGGATAAGCCTG No data
Right 1076252773 10:128996873-128996895 GTCATCTCTCTGCTCCTCTCAGG No data
1076252768_1076252774 22 Left 1076252768 10:128996839-128996861 CCAGCCTAGGGGGGATAAGCCTG No data
Right 1076252774 10:128996884-128996906 GCTCCTCTCAGGTTCCATGCTGG No data
1076252768_1076252776 29 Left 1076252768 10:128996839-128996861 CCAGCCTAGGGGGGATAAGCCTG No data
Right 1076252776 10:128996891-128996913 TCAGGTTCCATGCTGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076252768 Original CRISPR CAGGCTTATCCCCCCTAGGC TGG (reversed) Intergenic
No off target data available for this crispr