ID: 1076252818

View in Genome Browser
Species Human (GRCh38)
Location 10:128997061-128997083
Sequence CCTTCCTTAGGGACTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076252808_1076252818 9 Left 1076252808 10:128997029-128997051 CCAGGATCAGGGCTTGCAAAGGG No data
Right 1076252818 10:128997061-128997083 CCTTCCTTAGGGACTCAGGGAGG No data
1076252804_1076252818 22 Left 1076252804 10:128997016-128997038 CCTGTTACAGAAGCCAGGATCAG No data
Right 1076252818 10:128997061-128997083 CCTTCCTTAGGGACTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076252818 Original CRISPR CCTTCCTTAGGGACTCAGGG AGG Intergenic
No off target data available for this crispr