ID: 1076262419

View in Genome Browser
Species Human (GRCh38)
Location 10:129078331-129078353
Sequence AGATGCCAAGGGCCCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076262410_1076262419 12 Left 1076262410 10:129078296-129078318 CCACTCCAAATGCCAAAGGGGTC No data
Right 1076262419 10:129078331-129078353 AGATGCCAAGGGCCCTGCCAGGG No data
1076262414_1076262419 0 Left 1076262414 10:129078308-129078330 CCAAAGGGGTCTGTCCAGGGCAG No data
Right 1076262419 10:129078331-129078353 AGATGCCAAGGGCCCTGCCAGGG No data
1076262411_1076262419 7 Left 1076262411 10:129078301-129078323 CCAAATGCCAAAGGGGTCTGTCC No data
Right 1076262419 10:129078331-129078353 AGATGCCAAGGGCCCTGCCAGGG No data
1076262406_1076262419 19 Left 1076262406 10:129078289-129078311 CCAGAGGCCACTCCAAATGCCAA No data
Right 1076262419 10:129078331-129078353 AGATGCCAAGGGCCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076262419 Original CRISPR AGATGCCAAGGGCCCTGCCA GGG Intergenic
No off target data available for this crispr