ID: 1076262849

View in Genome Browser
Species Human (GRCh38)
Location 10:129082882-129082904
Sequence TTATGTTACAAAATGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076262849_1076262851 -7 Left 1076262849 10:129082882-129082904 CCATGCATCATTTTGTAACATAA No data
Right 1076262851 10:129082898-129082920 AACATAATGCAATGGTTATTTGG No data
1076262849_1076262852 3 Left 1076262849 10:129082882-129082904 CCATGCATCATTTTGTAACATAA No data
Right 1076262852 10:129082908-129082930 AATGGTTATTTGGAAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076262849 Original CRISPR TTATGTTACAAAATGATGCA TGG (reversed) Intergenic
No off target data available for this crispr