ID: 1076264819

View in Genome Browser
Species Human (GRCh38)
Location 10:129101433-129101455
Sequence GCAGGCCGCAGCTCGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076264819_1076264825 9 Left 1076264819 10:129101433-129101455 CCCCCCAGCGAGCTGCGGCCTGC No data
Right 1076264825 10:129101465-129101487 GAACCAGATCTGTGCAGTAAAGG No data
1076264819_1076264826 10 Left 1076264819 10:129101433-129101455 CCCCCCAGCGAGCTGCGGCCTGC No data
Right 1076264826 10:129101466-129101488 AACCAGATCTGTGCAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076264819 Original CRISPR GCAGGCCGCAGCTCGCTGGG GGG (reversed) Intergenic