ID: 1076271169

View in Genome Browser
Species Human (GRCh38)
Location 10:129153311-129153333
Sequence TGCCCATGTGCTTTGTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271169_1076271174 23 Left 1076271169 10:129153311-129153333 CCCTAAGACAAAGCACATGGGCA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data
1076271169_1076271175 24 Left 1076271169 10:129153311-129153333 CCCTAAGACAAAGCACATGGGCA No data
Right 1076271175 10:129153358-129153380 GCAAAGCCTTTGGAAAGTGAGGG No data
1076271169_1076271173 14 Left 1076271169 10:129153311-129153333 CCCTAAGACAAAGCACATGGGCA No data
Right 1076271173 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271169 Original CRISPR TGCCCATGTGCTTTGTCTTA GGG (reversed) Intergenic
No off target data available for this crispr