ID: 1076271170

View in Genome Browser
Species Human (GRCh38)
Location 10:129153312-129153334
Sequence TTGCCCATGTGCTTTGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271170_1076271173 13 Left 1076271170 10:129153312-129153334 CCTAAGACAAAGCACATGGGCAA No data
Right 1076271173 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
1076271170_1076271174 22 Left 1076271170 10:129153312-129153334 CCTAAGACAAAGCACATGGGCAA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data
1076271170_1076271175 23 Left 1076271170 10:129153312-129153334 CCTAAGACAAAGCACATGGGCAA No data
Right 1076271175 10:129153358-129153380 GCAAAGCCTTTGGAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271170 Original CRISPR TTGCCCATGTGCTTTGTCTT AGG (reversed) Intergenic
No off target data available for this crispr