ID: 1076271171

View in Genome Browser
Species Human (GRCh38)
Location 10:129153339-129153361
Sequence TTGCAAGATGCTGGAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271171_1076271179 17 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271179 10:129153379-129153401 GGTGAGCTCTGCAAAGGAGGAGG No data
1076271171_1076271175 -4 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271175 10:129153358-129153380 GCAAAGCCTTTGGAAAGTGAGGG No data
1076271171_1076271180 18 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG No data
1076271171_1076271178 14 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271178 10:129153376-129153398 GAGGGTGAGCTCTGCAAAGGAGG No data
1076271171_1076271177 11 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271177 10:129153373-129153395 AGTGAGGGTGAGCTCTGCAAAGG No data
1076271171_1076271174 -5 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data
1076271171_1076271181 22 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271171 Original CRISPR TTGCAAGATGCTGGAAATAG AGG (reversed) Intergenic
No off target data available for this crispr