ID: 1076271172

View in Genome Browser
Species Human (GRCh38)
Location 10:129153348-129153370
Sequence CCAAAGGCTTTGCAAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271172_1076271180 9 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG No data
1076271172_1076271178 5 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271178 10:129153376-129153398 GAGGGTGAGCTCTGCAAAGGAGG No data
1076271172_1076271179 8 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271179 10:129153379-129153401 GGTGAGCTCTGCAAAGGAGGAGG No data
1076271172_1076271177 2 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271177 10:129153373-129153395 AGTGAGGGTGAGCTCTGCAAAGG No data
1076271172_1076271181 13 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271172 Original CRISPR CCAAAGGCTTTGCAAGATGC TGG (reversed) Intergenic
No off target data available for this crispr