ID: 1076271174

View in Genome Browser
Species Human (GRCh38)
Location 10:129153357-129153379
Sequence TGCAAAGCCTTTGGAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271171_1076271174 -5 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data
1076271169_1076271174 23 Left 1076271169 10:129153311-129153333 CCCTAAGACAAAGCACATGGGCA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data
1076271170_1076271174 22 Left 1076271170 10:129153312-129153334 CCTAAGACAAAGCACATGGGCAA No data
Right 1076271174 10:129153357-129153379 TGCAAAGCCTTTGGAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271174 Original CRISPR TGCAAAGCCTTTGGAAAGTG AGG Intergenic
No off target data available for this crispr