ID: 1076271176

View in Genome Browser
Species Human (GRCh38)
Location 10:129153364-129153386
Sequence AGCTCACCCTCACTTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271176_1076271184 30 Left 1076271176 10:129153364-129153386 CCTTTGGAAAGTGAGGGTGAGCT No data
Right 1076271184 10:129153417-129153439 ATCCTGTGCAGATGACCTCCCGG No data
1076271176_1076271180 -7 Left 1076271176 10:129153364-129153386 CCTTTGGAAAGTGAGGGTGAGCT No data
Right 1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG No data
1076271176_1076271181 -3 Left 1076271176 10:129153364-129153386 CCTTTGGAAAGTGAGGGTGAGCT No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data
1076271176_1076271179 -8 Left 1076271176 10:129153364-129153386 CCTTTGGAAAGTGAGGGTGAGCT No data
Right 1076271179 10:129153379-129153401 GGTGAGCTCTGCAAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271176 Original CRISPR AGCTCACCCTCACTTTCCAA AGG (reversed) Intergenic