ID: 1076271181

View in Genome Browser
Species Human (GRCh38)
Location 10:129153384-129153406
Sequence GCTCTGCAAAGGAGGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076271171_1076271181 22 Left 1076271171 10:129153339-129153361 CCTCTATTTCCAGCATCTTGCAA No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data
1076271172_1076271181 13 Left 1076271172 10:129153348-129153370 CCAGCATCTTGCAAAGCCTTTGG No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data
1076271176_1076271181 -3 Left 1076271176 10:129153364-129153386 CCTTTGGAAAGTGAGGGTGAGCT No data
Right 1076271181 10:129153384-129153406 GCTCTGCAAAGGAGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076271181 Original CRISPR GCTCTGCAAAGGAGGAGGGA TGG Intergenic
No off target data available for this crispr