ID: 1076273167

View in Genome Browser
Species Human (GRCh38)
Location 10:129174488-129174510
Sequence CAGAGCAGAAAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076273167_1076273173 9 Left 1076273167 10:129174488-129174510 CCTGCCTCCTTCTTTCTGCTCTG No data
Right 1076273173 10:129174520-129174542 CCCCTGTCCCCCCAACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076273167 Original CRISPR CAGAGCAGAAAGAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr