ID: 1076273219

View in Genome Browser
Species Human (GRCh38)
Location 10:129174676-129174698
Sequence CTCTCTCTCTCCAACACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076273212_1076273219 -7 Left 1076273212 10:129174660-129174682 CCTCCTTCCCTTCTCTCTCTCTC No data
Right 1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG No data
1076273209_1076273219 12 Left 1076273209 10:129174641-129174663 CCTTTCTCCTCCTTATCTTCCTC No data
Right 1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG No data
1076273213_1076273219 -10 Left 1076273213 10:129174663-129174685 CCTTCCCTTCTCTCTCTCTCTCT 0: 30
1: 328
2: 1786
3: 6542
4: 20932
Right 1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG No data
1076273210_1076273219 5 Left 1076273210 10:129174648-129174670 CCTCCTTATCTTCCTCCTTCCCT No data
Right 1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG No data
1076273211_1076273219 2 Left 1076273211 10:129174651-129174673 CCTTATCTTCCTCCTTCCCTTCT No data
Right 1076273219 10:129174676-129174698 CTCTCTCTCTCCAACACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076273219 Original CRISPR CTCTCTCTCTCCAACACCGG GGG Intergenic
No off target data available for this crispr