ID: 1076273469

View in Genome Browser
Species Human (GRCh38)
Location 10:129176421-129176443
Sequence CTGGGTTGTAACTCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076273465_1076273469 1 Left 1076273465 10:129176397-129176419 CCGCCATTGTTTGTTGATGGATT No data
Right 1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG No data
1076273466_1076273469 -2 Left 1076273466 10:129176400-129176422 CCATTGTTTGTTGATGGATTGCT No data
Right 1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG No data
1076273462_1076273469 15 Left 1076273462 10:129176383-129176405 CCTCACTGAGCCATCCGCCATTG No data
Right 1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG No data
1076273463_1076273469 5 Left 1076273463 10:129176393-129176415 CCATCCGCCATTGTTTGTTGATG No data
Right 1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076273469 Original CRISPR CTGGGTTGTAACTCTGTTGC AGG Intergenic
No off target data available for this crispr