ID: 1076276109

View in Genome Browser
Species Human (GRCh38)
Location 10:129200111-129200133
Sequence CAGTGTTCTCCCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076276109_1076276114 -4 Left 1076276109 10:129200111-129200133 CCCACTTCCCTGGGAGAACACTG No data
Right 1076276114 10:129200130-129200152 ACTGGTAGTACTTGCCTCAGAGG No data
1076276109_1076276117 28 Left 1076276109 10:129200111-129200133 CCCACTTCCCTGGGAGAACACTG No data
Right 1076276117 10:129200162-129200184 AGGTTAAAGAATTCATACGCAGG No data
1076276109_1076276115 8 Left 1076276109 10:129200111-129200133 CCCACTTCCCTGGGAGAACACTG No data
Right 1076276115 10:129200142-129200164 TGCCTCAGAGGACTGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076276109 Original CRISPR CAGTGTTCTCCCAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr