ID: 1076276743

View in Genome Browser
Species Human (GRCh38)
Location 10:129205934-129205956
Sequence CTATTTTACAAGCAAACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076276743_1076276746 14 Left 1076276743 10:129205934-129205956 CCAATGGTTTGCTTGTAAAATAG No data
Right 1076276746 10:129205971-129205993 CAAAAGGCCAACTATACACCTGG No data
1076276743_1076276744 -2 Left 1076276743 10:129205934-129205956 CCAATGGTTTGCTTGTAAAATAG No data
Right 1076276744 10:129205955-129205977 AGATTCCAGATTATTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076276743 Original CRISPR CTATTTTACAAGCAAACCAT TGG (reversed) Intergenic
No off target data available for this crispr