ID: 1076280270

View in Genome Browser
Species Human (GRCh38)
Location 10:129240929-129240951
Sequence TGTCGAATCCACATTCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076280267_1076280270 0 Left 1076280267 10:129240906-129240928 CCTGGGAGGCACCTTCCTGCAGT No data
Right 1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG No data
1076280266_1076280270 8 Left 1076280266 10:129240898-129240920 CCAGGAATCCTGGGAGGCACCTT No data
Right 1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG No data
1076280263_1076280270 17 Left 1076280263 10:129240889-129240911 CCAGGGGATCCAGGAATCCTGGG No data
Right 1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG No data
1076280260_1076280270 25 Left 1076280260 10:129240881-129240903 CCCAGCATCCAGGGGATCCAGGA No data
Right 1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG No data
1076280261_1076280270 24 Left 1076280261 10:129240882-129240904 CCAGCATCCAGGGGATCCAGGAA No data
Right 1076280270 10:129240929-129240951 TGTCGAATCCACATTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076280270 Original CRISPR TGTCGAATCCACATTCAATG TGG Intergenic
No off target data available for this crispr