ID: 1076282329

View in Genome Browser
Species Human (GRCh38)
Location 10:129258825-129258847
Sequence AACCAGGAGCTCAGCTCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076282329_1076282334 29 Left 1076282329 10:129258825-129258847 CCATCGGAGCTGAGCTCCTGGTT No data
Right 1076282334 10:129258877-129258899 TTTCTGGCTATTCTACAGAGCGG No data
1076282329_1076282331 -1 Left 1076282329 10:129258825-129258847 CCATCGGAGCTGAGCTCCTGGTT No data
Right 1076282331 10:129258847-129258869 TTGATAGTTGAATGTCCTGATGG No data
1076282329_1076282332 13 Left 1076282329 10:129258825-129258847 CCATCGGAGCTGAGCTCCTGGTT No data
Right 1076282332 10:129258861-129258883 TCCTGATGGTGTTTTTTTTCTGG No data
1076282329_1076282335 30 Left 1076282329 10:129258825-129258847 CCATCGGAGCTGAGCTCCTGGTT No data
Right 1076282335 10:129258878-129258900 TTCTGGCTATTCTACAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076282329 Original CRISPR AACCAGGAGCTCAGCTCCGA TGG (reversed) Intergenic