ID: 1076286072

View in Genome Browser
Species Human (GRCh38)
Location 10:129297650-129297672
Sequence CTAGTTTCCCATGATTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076286071_1076286072 26 Left 1076286071 10:129297601-129297623 CCTCTGAGAAAATCTTGGGCAAT No data
Right 1076286072 10:129297650-129297672 CTAGTTTCCCATGATTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076286072 Original CRISPR CTAGTTTCCCATGATTCTGC AGG Intergenic
No off target data available for this crispr