ID: 1076288357

View in Genome Browser
Species Human (GRCh38)
Location 10:129323542-129323564
Sequence ATTGCCGATTAGGAGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076288357_1076288366 12 Left 1076288357 10:129323542-129323564 CCACTTCTCTCCTAATCGGCAAT No data
Right 1076288366 10:129323577-129323599 GTTGCCACGCAGTCTGGGGCTGG No data
1076288357_1076288363 6 Left 1076288357 10:129323542-129323564 CCACTTCTCTCCTAATCGGCAAT No data
Right 1076288363 10:129323571-129323593 CGGGCTGTTGCCACGCAGTCTGG No data
1076288357_1076288364 7 Left 1076288357 10:129323542-129323564 CCACTTCTCTCCTAATCGGCAAT No data
Right 1076288364 10:129323572-129323594 GGGCTGTTGCCACGCAGTCTGGG No data
1076288357_1076288365 8 Left 1076288357 10:129323542-129323564 CCACTTCTCTCCTAATCGGCAAT No data
Right 1076288365 10:129323573-129323595 GGCTGTTGCCACGCAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076288357 Original CRISPR ATTGCCGATTAGGAGAGAAG TGG (reversed) Intergenic