ID: 1076288359

View in Genome Browser
Species Human (GRCh38)
Location 10:129323552-129323574
Sequence CCCGGGAGCAATTGCCGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076288359_1076288365 -2 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288365 10:129323573-129323595 GGCTGTTGCCACGCAGTCTGGGG No data
1076288359_1076288368 24 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288368 10:129323599-129323621 GTGTCTTCCAAGATGACACCAGG No data
1076288359_1076288366 2 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288366 10:129323577-129323599 GTTGCCACGCAGTCTGGGGCTGG No data
1076288359_1076288364 -3 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288364 10:129323572-129323594 GGGCTGTTGCCACGCAGTCTGGG No data
1076288359_1076288363 -4 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288363 10:129323571-129323593 CGGGCTGTTGCCACGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076288359 Original CRISPR CCCGGGAGCAATTGCCGATT AGG (reversed) Intergenic