ID: 1076288363

View in Genome Browser
Species Human (GRCh38)
Location 10:129323571-129323593
Sequence CGGGCTGTTGCCACGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076288357_1076288363 6 Left 1076288357 10:129323542-129323564 CCACTTCTCTCCTAATCGGCAAT No data
Right 1076288363 10:129323571-129323593 CGGGCTGTTGCCACGCAGTCTGG No data
1076288359_1076288363 -4 Left 1076288359 10:129323552-129323574 CCTAATCGGCAATTGCTCCCGGG No data
Right 1076288363 10:129323571-129323593 CGGGCTGTTGCCACGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076288363 Original CRISPR CGGGCTGTTGCCACGCAGTC TGG Intergenic