ID: 1076288914

View in Genome Browser
Species Human (GRCh38)
Location 10:129328972-129328994
Sequence TATTTTTTTTCCCAGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076288914_1076288915 -10 Left 1076288914 10:129328972-129328994 CCTGGCAGCTGGGAAAAAAAATA No data
Right 1076288915 10:129328985-129329007 AAAAAAAATAGCCCACACTGCGG No data
1076288914_1076288916 -7 Left 1076288914 10:129328972-129328994 CCTGGCAGCTGGGAAAAAAAATA No data
Right 1076288916 10:129328988-129329010 AAAAATAGCCCACACTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076288914 Original CRISPR TATTTTTTTTCCCAGCTGCC AGG (reversed) Intergenic
No off target data available for this crispr